User Tools

Site Tools













Intron 11: gtgagttgtctctgctttgtctccaaatcctgcaggcgggtccctggtc atcgaggggtaggacgaggtggccttgcaggggggagagcctgccttctc ttccgcagcccgggggagtgggagcctcctccccacagcctgagtcctag acagcccacctctgcatcctgcccctcttgtctgagccccagactggagg gcaggggcagggctggagtgtgagggatgggggagatgctacctcccttc taggggccaggggagggagggtctgggtccaggccctgctgctcacacct ctctcctctgttttctctcttag


human_lmna_exons_intron_11.txt · Last modified: 2020/02/27 18:22 (external edit)