User Tools

Site Tools


human_lmna_exons
hg18_refGene_NM_170707

Exon 1: ACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCG AGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCG AGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGA CCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCC AACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGG GGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGC AGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATC GACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCAT CACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCG CCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCC AAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTT TAAGGAGCTGAAAGCGCG

Exon 2: CAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCT CGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAG CACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGC GGGGCCAGGTGGCCAAG

Exon 3: CTTG AGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGG CGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTT CCAGAAGAACATCTACAGTGAG

Exon 4: GA GCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACA ATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAA CTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGA GAAGACTTATTCTGCCAAG

Exon 5: CTGGACAATGCCAGGCAGTC TGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGC AGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAG AAGCAG

Exon 6: CTGGCA GCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCG GGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGA TGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGAC ATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGA GGGCGAGGAGGAGAG

Exon 7: GCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGC CGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAA AAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACG CACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAG TTTGTCCGGCTGCGCAACAAGTCCAATGAG

Exon 8: GACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAG AATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCT GAAGGCTGGGCAGGTGGTGACG

Exon 9: ATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGA CCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTA CGGCTCTCATCAACTCCACTGGGGAA

Exon 10: GAA GTGGCCATGCGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGA GGATGAGGATGGAGATGACCTGCTCCATCACCACCAC

Exon 11: GGCTCCCACTGCAGCAGCT CGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGG ACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCA GGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCA CTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGAC AATCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAACCCA G

Exon 12: AGCCCCCAGAACTGCAGCATCATGTAA TCTGGGACCTGCCAGGCAGGGGTGGGGGTGGAGGCTTCCTGCGTCCTCCT CACCTCATGCCCACCCCCTGCCCTGCACGTCATGGGAGGGGGCTTGAAGC CAAAGAAAAATAACCCTTTGGTTTTTTTCTTCTGTATTTTTTTTTCTAAG AGAAGTTATTTTCTACAGTGGTTTTATACTGAAGGAAAAACACAAGCAAA AAAAAAAAAAAGCATCTATCTCATCTATCTCAATCCTAATTTCTCCTCCC TTCCTTTTCCCTGCTTCCAGGAAACTCCACATCTGCCTTAAAACCAAAGA GGGCTTCCTCTAGAAGCCAAGGGAAAGGGGTGCTTTTATAGAGGCTAGCT TCTGCTTTTCTGCCCTGGCTGCTGCCCCCACCCCGGGGACCCTGTGACAT GGTGCCTGAGAGGCAGGCATAGAGGCTTCTCCGCCAGCCTCCTCTGGACG GCAGGCTCACTGCCAGGCCAGCCTCCGAGAGGGAGAGAGAGAGAGAGAGG ACAGCTTGAGCCGGGCCCCTGGGCTTGGCCTGCTGTGATTCCACTACACC TGGCTGAGGTTCCTCTGCCTGCCCCGCCCCCAGTCCCCACCCCTGCCCCC AGCCCCGGGGTGAGTCCATTCTCCCAGGTACCAGCTGCGCTTGCTTTTCT GTATTTTATTTAGACAAGAGATGGGAATGAGGTGGGAGGTGGAAGAAGGG AGAAGAAAGGTGAGTTTGAGCTGCCTTCCCTAGCTTTAGACCCTGGGTGG GCTCTGTGCAGTCACTGGAGGTTGAAGCCAAGTGGGGTGCTGGGAGGAGG GAGAGGGAGGTCACTGGAAAGGGGAGAGCCTGCTGGCACCCACCGTGGAG GAGGAAGGCAAGAGGGGGTGGAGGGGTGTGGCAGTGGTTTTGGCAAACGC TAAAGAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCC CAAATCAATACACTAGTTGTTTCT

human_lmna_exons.txt · Last modified: 2020/02/27 18:22 (external edit)