User Tools

Site Tools













Intron 11: gtgagttgtctctgctttgtctccaaatcctgcaggcgggtccctggtc atcgaggggtaggacgaggtggccttgcaggggggagagcctgccttctc ttccgcagcccgggggagtgggagcctcctccccacagcctgagtcctag acagcccacctctgcatcctgcccctcttgtctgagccccagactggagg gcaggggcagggctggagtgtgagggatgggggagatgctacctcccttc taggggccaggggagggagggtctgggtccaggccctgctgctcacacct ctctcctctgttttctctcttag


human_lmna_exons_intron_11.txt · Last modified: 2012/12/07 13:48 (external edit)